Compartir

Una cacerola llevó a Carlos Parra del balcón a comisaría

Su hermana Karla Parra y Beltrán Benítez fueron apresados por funcionarios de la Policía del Táchira.

imageRotate
La casa de los Parra está a metros del sitio donde estaba Maduro (@noticierovenezuela)
ENDER MARCANO , LORENA ARRAÍZ |  EL UNIVERSAL
lunes 20 de mayo de 2013  09:08 AM
El "gobierno de calle" de Nicolás Maduro llegó este fin de semana al estado Táchira, específicamente en La Grita, y como se ha hecho costumbre en muchos de los lugares que ha visitado en su mes de mandato, las cacerolas también lo acompañaron. A pesar de que tocar ollas es una manifestación pacífica, en esta oportunidad dejó el saldo de tres detenidos bajo cargos desconocidos.

Carlos Parra, su hermana Karla Parra y Beltrán Benítez fueron apresados por funcionarios de la Policía del Táchira.

Carlos Parra, de 19 años de edad y quien es dirigente juvenil de Primero Justicia, contó que aproximadamente al mediodía del sábado llegó el presidente Maduro a La Grita. De acuerdo con su relato, estaba acompañado por una multitud de cerca de 115 personas, entre los que se encontraban los escoltas del primer mandatario nacional.

Ya con Maduro en el lugar comenzaron a sonar las cacerolas, en el caso de Parra desde el balcón de su casa que se encuentra a escasos 15 metros del punto en el cual se realizó el acto.

Mientras se producía el cacerolazo, el dirigente de Primero Justicia comentó que personas de la multitud que acompañaba a Maduro comenzaron a arrojar objetos como piedras a su residencia. Según señaló, quienes encabezaban las agresiones son líderes políticos del municipio.

En ese momento no se produjo la detención. Minutos después de que culminó el acto se acercaron dos funcionarios de la Policía del Táchira, junto a dos efectivos de la Fuerza Armada y es allí cuando fue llevado a la comandancia de la policía en La Grita. "No fui esposado, ni hubo agresiones, ni nada. Ellos (los policías) entraron a mi casa, aunque no debieron hacerlo porque no tenían orden de captura, pero todo lo hicieron sin violencia", dijo Parra.

La explicación para llevárselo de su casa, a él y su hermana Karla, fue "para hablar unas cositas".

Desde La Grita fueron trasladados a la sede del Servicio Bolivariano de Inteligencia (Sebin) en La Fría. "Los funcionarios del Sebin dijeron que nos llevaron por unas averiguaciones, para verificar nuestro expediente que hasta ayer estaba intachable, hasta que nos detuvieron por cacerolear en el balcón de mi casa", explicó.

El único argumento que se dio a la familia Parra es que se trataba, al parecer, de órdenes de Casa Militar, de "altos mandos", dijo. La liberación se produjo, de acuerdo a las palabras del detenido, por malos procedimientos al apresarlos.

Por otra parte, Leonardo Sánchez Cárdenas, estudiante de Comunicación Social de la ULA fue también detenido en horas de la noche del sábado pasado mientras tomaba fotografías de las afueras del Sebin para mostrar el ambiente a esa hora de la noche puesto que habían al menos unas 40 personas aguardando por la liberación de los hermanos Parra y Benítez.

Funcionarios del Sebin lo interrogaron sobre el destino de las imágenes. El joven estudiante manifestó haber recibido un buen trato y explicó que eran para una nota periodística.

Al parecer, dentro de ese cuerpo se hallaba detenido un irregular y los funcionarios creían que Sánchez Cárdenas hacía trabajo de contra inteligencia a favor de un grupo paramilitar.

Compartir
¡Participa!

Envíanos tus comentarios
Para escribir tus comentarios en las notas, necesitas ser usuario registrado
de EL UNIVERSAL. Si no lo eres, Regístrate aquí
correo (obligatorio)
clave (obligatorio)
Ingresar
El Universal respeta y defiende el derecho a la libre expresión, pero también vela por el respeto a la legalidad y a los participantes en este foro. Invitamos a nuestros usuarios a mantener un contenido y vocabulario adecuado y apegado a las leyes.
El Universal no se hace responsable por las opiniones emitidas en este espacio. Los comentarios aquí publicados son responsabilidad de quién los escribe.
El Universal no permite la publicación de mensajes anónimos o bajo seudónimos.
El Universal se reserva el derecho de editar los textos y de eliminar aquellos que utilicen un lenguaje no apropiado y/o que vaya en contra de las leyes venezolanas.
Comentarios (28)
páginas:
1 | 2 | 3 |
Por juan carmona
20.05.2013
11:03 PM
José Labastidas Hernández, permíteme recordarte que los hombres que sueñan con hombres son los chavistas. Así que si quieres buscar gays pues búscalos en las filas del chavismo que sueñan todo el tiempo con su comandante.
 
Por Maria Flores
20.05.2013
6:05 PM
Pero por que en lugar de apresar a la gente de bien no van tras los malandros????? Yo me acuerdo que el ilegitimo en campaña dijo que se iba a meter a los barrios a desarmar a los MUCHACHITOS DESCARRIADOS que usan armas de guerra para sus fechorias.... malvivientes eso es lo que deberian de mandar para Cuba en lugar de mandarles nuestro petroleo... mandarles malandros GRATIS para que vean ellos lo que es bueno....
 
Por Gloria Wilges Muñoz de Morrell
20.05.2013
5:18 PM
tacatacatacatacatacatacatacatacatactacatacatacatacatacataca TATATATATATATATATATACATACATACATACATACATACATACATACATACATACATACA TACATACATACATACATACATACATACATACATACATACATACATACATACATACATACATAC
 
Por JOSE LABASTIDAS HERNANDEZ
20.05.2013
4:56 PM
LOS ENFERMOS CAPITALUSTOIDES TIENEN LA CACEROLA EN SU MENTE DIA Y NOCHE PORQUE HASTA DUERMEN CON ELLA SOÑANDO QUE LA SUENAN CUANDO TIENEN PESADILLAS CON EL COMANDANTE CHAVEZ...
 
Por lilia white
20.05.2013
11:37 AM
ES INCREIBLE QUE CASI TODOS LOS DIAS ALGUIEN ES APRESADO POR COSAS ESTUPIDAS Y SIN VALOR REAL. SERA ESO UN SIGNO DE UN GOBIERNO VENGATIVO? QUE NO CONOCE DE LEYES Y QUE NO LE IMPORTA UN COMINO ACTUAR DE UNA MANERA SALVAJE AL ESTILO DE UN GANG? SEGUIRA ESTA CACERIA DE BRUJAS POR COSAS ESTUPIDAS Y SIN MERITO DURANTE TODO EL REGIMEN?
 
Por Alida Cusati
20.05.2013
11:26 AM
Ahora es cuando SEGUIREMOS CACEROLEANDO!!! Maduro, acá te la dedico tacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacatacataca.... ¿NO TE GUSTÓ? ENTONCES RENUNCIA Y VETE PARA CUBA!!!!
 
Por Rafael Concalves
20.05.2013
11:12 AM
AL COMUNISTOIDE ILEGITIMO NO LE GUSTA QUE LO CACEROLEEEN....
 
Por francisco jose salazar marquez
20.05.2013
11:08 AM
bueno, ya sabemos, cuando el ...maduro esté cerca...a cacerolear!!!!!!!!!! es la voz!!!
 
Por Gustavo Lopez
20.05.2013
11:08 AM
asi es que se gobierna caray...!!!
 
Por Carlos Rodriguez
20.05.2013
10:54 AM
Ah es que seguro este es otro logro del nuevo plan de seguridad, detener a dos venezolanos por cacerolear, que ridiculez, y mientras tanto todos los malandros de verdad haciendo lo que les da la gana.
 
páginas:
1 | 2 | 3 |
ESPACIO PUBLICITARIO
ESPACIO PUBLICITARIO
cerrar